Journal Search Engine
Search Advanced Search Adode Reader(link)
Download PDF Export Citaion korean bibliography PMC previewer
ISSN : 1225-8504(Print)
ISSN : 2287-8165(Online)
Journal of the Korean Society of International Agricultue Vol.30 No.4 pp.277-284
DOI : https://doi.org/10.12719/KSIA.2018.30.4.277

The identification of non-synonymous SNP in the Enoyl-CoA delta isomerase 2 (ECI2) gene and its Association with Meat Quality Traits in Berkshire pigs

Jung Hye Hwang*, Sang Mi An*, Da Hye Park*, Deok Gyeong Kang*, Tae Wan Kim*, Hwa Chun Park**, Jeongim Ha*,†, Chul Wook Kim*,†
*Swine Science and Technology Center, Gyeongnam National University of Science & Technology, 33, Dongjin-ro, Jinju-si, Gyeongsangnam-do, Republic of Korea, 52725
**Dasan Pig Breeding Co. 580-25, Seungjeon-ro, Unbong-eup, Namwon-si, Jeollabuk-do, Republic of Korea, 55716
Corresponding author : (Phone) +82-55-751-3281 (E-mail) cwkim@gntech.ac.kr (Phone) +82-55-751-3289 (E-mail) jiha@gntech.ac.kr
August 30, 2018 October 29, 2018 November 2, 2018

Abstract


Meat quality has always been one of the most important factors that controls the choice of pork consumers and is of great interest in the pig industry. In this study, we identified a single nucleotide polymorphism (SNP) in the enoyl-CoA delta isomerase 2 (ECI2) gene in Berkshire pigs (n = 430) by analyzed the association between the SNP and meat quality traits. The non-synonymous SNP in the ECI2 gene is located at c.608 C > G and resulted in an amino acid change from threonine to serine. Significant associations between the SNP and meat quality traits, such as redness (CIE a), and the pH24hr, were revealed in both the dominant and co-dominant models, whereas carcass weight, drip loss, and fat content and moisture content were significantly associated only with the dominant model. In barrow, the SNP was significantly associated with CIE a, drip loss, and pH24hr, whereas in gilt, only a significant relationship with moisture content was observed. GG genotype pigs had a higher pH24hr and lower drip loss. Because pH24hr and drip loss are considered the most important meat quality traits, GG genotype pork is high-quality meat compared to that from other genotypes. In conclusion, the SNP in the ECI2 gene is significantly associated with several meat quality traits. These traits and could be as genetic markers in molecular breeding programs for improving meat quality.



버크셔 돼지 육질 형질과 Enoyl-CoA delta isomerase 2 (ECI2) 유전자 nsSNP의 연관성 분석

황 정혜*, 안 상미*, 박 다혜*, 강 덕경*, 김 태완*, 박 화춘**, 하 정임*,†, 김 철욱*,†
*경남과학기술대학교 양돈과학기술센터
**다산육종

초록


    Gyeongnam National University of Science and Technology

    서 언

    돼지고기의 육질은 소비자가 돼지고기를 선택하는 가장 중 요한 요인 중 하나이며 고품질 돈육의 생산은 돼지 산업의 수 익성 향상을 위한 주요 목표이다. 육질은 유전 및 환경적 요인 들과 상호 작용에 의해 결정되며, 높은 유전력을 가지고 있다 (Warner et al. 2010;Mortimer et al. 2014). 많은 연구들이 육질과 관련된 유전자 마커를 확보하기 위한 연구를 수행하고 있지만(Cho et al. 2015;Kwon et al. 2016;Park et al. 2017), 여전히 소비자를 충족시킬 수 있는 고품질 돈육을 생산 하기 위한 분자 육종 기술 개발이 필요한 실정이다.

    돼지의 품종 중 Berkshire 품종은 다른 품종에 비해 중성 지질 지방산과 마블링 지방의 비율이 높고 육질이 우수하다고 알려져 있다(Wood et al. 2004). 육질에 영향을 미치는 주요 요인 중 하나는 사후 근육의 pH이며 사후 근육 pH는 단백질 의 변성, 육색, 보수력, 가열 감량 등과 같은 육질 형질에 영향 을 미치는 것으로 알려져 있다(Huff-Lonergan et al. 2002;Kayan et al. 2011;Wu et al. 2014). 한 예로 비정상적으로 낮은 pH는 근섬유 단백질의 변성을 일으켜 보수력을 감소시 킨다고 밝혀졌다(Scheffler & Gerrard 2007;Wu et al. 2014). 현재까지 CIDE-B, CBG, DHRS4, SERPING1, APOR 유전자의 SNP가 사후 pH에 영향을 주는 것으로 선행 연구에 서 보고하였다(Kwon et al. 2016;Hwang et al. 2017a;Yu et al. 2017). 돼지의 육질을 향상시키기 위한 분자 육종 기술 에 유전자 마커의 활용이 중요함에 따라 돼지의 육질과 관련 된 유전자 마커를 탐색하고 확보하기 위해 본 연구를 수행하 였다.

    Enoyl-CoA delta isomerase (ECI2)는 hydratase, isomerase superfamily 구성원을 암호화하는 유전자이며 ECI2 단백질은 불포화 지방산의 산화에 관여하는 중요한 미토콘드리아 효소 로 알려져 있다(Mursula et al. 2001;van Weeghel et al. 2012). ECI2는 불포화 지방산의 지방산 분해에서 가장 빈번하 게 사용되는 경로 중 하나인 지방산 β 산화에 결정적인 역할 을 한다(Mursula et al. 2001;van Weeghel et al. 2012;Keogh et al. 2016). 소에서 ECI2 유전자는 β 산화에 관여하 는 유전자로 연구보고되었으며 ECI2 발현이 포화지방산과 불 포화 지방산의 산화를 나타내는 식이제한 급여 그룹에서 더 증가되었다(Keogh et al. 2016). Rat과 Mouse의 ECI2 유전 자는 신장에서 발현되며 GO 분석 및 KEGG 분석 결과 지방 산 대사 경로, 모노카르복실산 이화 경로(fatty acid metabolic process, Monocarboxylic acid catabolic process) 등에서 역할 을 하는 것으로 나타났다(van Weeghel et al. 2014<XREF>). 지방산은 지방의 탄력 및 풍미 조절을 통해 육질에 중요한 역 할을 하며 특히 불포화 지방산의 산화는 육질에 도움이 된다 (Wood et al. 2005). 불포화 지방산의 산화에 관여하는 유전 자로 ECI2 가 알려져 있어, 본 연구자들은 ECI2 유전자가 육질과 연관성이 있을 가능성을 예측할 수 있었다. 하지만, 돼 지에서 ECI2 유전자는 사료 효율성에 관여하며 에너지 생성 및 활용에 역할을 하는 것으로 알려져 있지만(Reyer et al. 2017), 육질 형질 간의 연관성에 관한 연구는 보고된 바가 없 다. 따라서 본 연구에서는 ECI2 유전자의 SNP를 밝히고 Berkshire 돼지 육질과의 연관성을 규명하고자 한다. 특히 육 질 형질 중에서도 지방의 함량 조절 등에 최초의 연구 결과가 될 수 있을 것으로 사료된다. 이러한 연구 결과는 육질이 우 수한 돼지를 선발하는 데 있어 유용한 유전자 마커로서 활용 이 가능할 것으로 사료된다.

    재료 및 방법

    공시 동물

    본 연구에서는 버크셔 품종의 간 조직을(n=3) 채취하여 단 일염기다형성(SNP) 검색에 사용하였고, 유전자형과 육질 분석 을 위해 동일한 조건에서 사육된 체중 110 kg의 Berkshire 돼 지 430두(거세돈 199, 암돈 213) (다산 육종, 남원)의 혈액으 로 유전자형 분석과 등심 조직을 채취하여 육질 분석에 사용 하였다.

    Veracode GoldenGate assay kit를 사용한 ECI2 유전 자형 분석

    ECI2 유전자에서 단일염기다형성의 유전자형을 분석하기 위해 genomic DNA 분리 후 단일염기다형성의 위치에 각 각의 대립 유전자형에 특이적으로 결합하는 대립유전자 특 이 올리고 뉴클레오티드와 단일염기다형성 위치의 염기쌍 하부에 결합되는 지역 특이적인 프라이머를 사용하여 Veracode GoldenGate assay kit (Illumina, Inc., CA, USA) 방법으로 분석하였다. 혈액에서 genomic DNA(gDNA) 추출은 Promega사(USA)의 Wizard?Genomic DNA Purification kit을 사용하였다. 추출된 gDNA는 NanoDrop ND-1000 spectrophotometer (Thermo, USA)로 흡광도를 측정하였고, 50 ng/uL로 희석한 DNA를 분석에 이용하였다. ECI2 유전자 의 SNP 분석을 위해 사용된 Golden Gate assay kit primer는 대립유전자 특이 올리고 뉴클레오티드 1: 5’- ACTTCGTCAGTAACGGACTTACTGTAGCGGCAATGACC TGAC-3’, 대립유전자 특이 올리고 뉴클레오티드 2: 5’- GAGTCGAGGTCATATCGTTTACTGTAGCGGCAATGACC TGAG-3’, 대립유전자 특이 올리고 뉴클레오티드 3: 5’- ACTTCAAGGATATCCCCCACCACGACCTTTTCGCCTGTA GGTCTGCCTATAGTGAGTC-3’와 같은 서열을 가졌다.

    육질 분석

    육질 분석을 위해 전라남도 남원, 다산 육종의 동일한 환경 에서 사육된 버크셔 돼지 430 두를 도 체중 110 kg에서 도 축하였다. 도축된 등심 조직을 채취 후 액체 질소로 냉동한 후 -80℃에 보관하여 육질 분석에 사용하였다. 육질 분석 방 법은 Hwang et al.(2017b)의 방법에 따라 측정하였다. 요약하 자면, 등 지방 두께(Backfat thickness)는 좌 반도체 11~12번 째 늑골 사이 및 최종 늑골 위쪽을 측정하였고, 사후 pH은 등심 부위에서 pH 미터(pH*K21, NWK -Binr GmbH Co., Germany)를 사용하여 각각 3회 반복 측정한 값을 평균으로 사용하였다. 돈육의 수분(Moisture), 단백질(Protein), 지방(Fat) 및 콜라겐(Collagen) 조성은 제9늑골~11늑골 부위 등 심근과 제1요추~제4요추까지의 등 심근을 2반복 시료로 Anderson 등 (2007)의 방법에 따라 Foodscan(Foss co, Food scanTM Lab, Type 78810, Denmark)을 이용하여 분석하였다. 육색 (Meat color)은 제8늑골 부위와 제12늑골 부위의 등심을 이용 하여 색차계(Minolta Co. CR 400, Japan)로 육 색의 명도, 적색도, 황색도(Commision Internationale de Leclairage: CIE, Lightness: L*, Redness: a*, Yellowness: b*) 값을 9회 반복 측정하였으며, 보수력(Water holding capacity)은 등심을 이용하여 Park 등(2001)의 방법에 따라 측정하였다. 드립 감량 (Drip loss)은 등심을 진공포장하여 4℃ 냉장고에서 24시간 저 장하여 전후의 중량 차로 계산하였고, 가열 감량(Cooking loss)은 항온 수조(Dehan Scientific Co. Model WSB-45, Korea)를 사용하여 70℃에서 10분간 가열한 후 가열 전후 중 량 차로 계산하였다. 전단력(Warner-Bratzler shear force)은 등심을 채취하여 전단력 측정기(Instron Universal Testing Machine, Model 5543, USA)을 이용하여 측정한 값을 kg으 로 나타내었다.

    통계분석

    검색된 단일염기다형성의 유전자형과 육질 형질과의 연관성 확인을 위해 SAS version 9.1.3(SAS Institute Inc., Cary NC, USA)를 이용하여 통계분석을 실행하였다. 통계분석을 위한 단 일염기다형성은 선택 비율(call rate) 0.90, 대립유전자 빈도 (minor allele frequencies, MAFs) > 0.01, 하디-와인버그 법칙 (Hardy-Weinberge equilibrium, HWE) p > 0.05에 의해 선택 하였다. 선형모델 yij=μ+Gi+Sj+eij 을 이용하였고, 여기서 yij 표현 형의 특성 값, μ: 일반 평균, Gi: Genotype i의 고정 효과, Sj: Sex j의 고정 효과, eij: 오류 값을 나타낸다. 각각 우성, 열성, 공우성 모델에 Mann-Whitney와 Student’s test 및 ANOVA와 t-test를 사용하여 유의성을 확인하였다(p < 0.01, p < 0.05).

    결과 및 고찰

    단일염기다형성 검색 및 유전자형 분석

    버크셔 품종은 다른 품종에 비해 마블링이 좋고 pH가 높아 육즙이 풍부하며 육질의 연도와 향미가 좋은 장점을 가지고 있다(Crawford et al. 2010). 간은 소화 기능, 호르몬 생성 및 해독에 중요한 역할을 하는 다양한 대사 과정을 조절하고 지 방 조직, 골격근과 함께 지질대사를 조절하는데 중요하다. 특 히 돼지에서 간은 콜레스테롤 합성과 지방산 산화를 담당하는 주요 장기이며 이러한 기능은 돼지 육질에 다양한 영향을 미 칠 수 있을 것으로 사료된다(O'Hea & Leveille 1969;Mourot et al. 1995;Nafikov & Beitz 2007;Nguyen et al. 2008). 따라서 육질이 우수한 Berkshire 간조직을 이용하여 SNP를 확인한 결과 ECI2 유전자는 Synonymous SNP(sSNP) 1개, non-Synonumous SNP(nsSNP) 1개로 총 2개의 SNP (nsSNP:rs327509542, sSNP:rs344123886) 가 발견되었고(Table 1), 본 연구에서는 그중 아미노산의 변화를 가져오는 단일염기 다형성 (nsSNP)은 단백질 구조 및 기능 변화에 따라 다양한 형질에 영향을 미칠 것으로 예상되어 육질 형질과 연관성 분 석을 수행하였다. ECI2 유전자의 단일염기다형성은 돼지의 7 번 염색체의 g.2302809에 위치하며 cDNA 608 C 서열이 G 로 변이되는 SNP로 Threonine 아미노산이 Serine로 전환을 확인하였다(rs327509542, 7:2434825, Sscrofa 11.1). Threonine 에서 Serine으로 전환되는 단일염기다형성의 경우 동일한 극 성 아미노산 그룹에 속하여 단백질의 구조적 변이와 기능에 크게 영향을 주지 못할 것으로 예상이 되지만, 최근 사람의 암에 관한 단일염기다형성 연구 논문에서 아미노산의 변화가 없는 synonymous SNP의 경우에도 mRNA의 구조와 안정성, 전사 반응의 효율성, alternative 스플라이싱 등에 영향을 미쳐 단백질의 양이나 구조 등에 변화를 미치게 한다고 보고하고 있다(Sauna et al. 2007). 또한 본 연구 그룹에 의해서 발표 된 최근 연구 결과에서 돼지 육질에 유의적으로 연관성이 있 는 PGM1 유전자의 단일염기다형성 또한 synonymous SNP로 밝혀졌다(Hwang et al. 2014). 물론 단일염기다형성으로 인한 표현형의 차이가 어떤 메커니즘에 의한 것인지는 더 연구가 필요하겠지만 본 연구에서는 육질 형질과 ECI2 유전자의 SNP와 연관성 분석을 통해 유전자 형에 따른 육질 예측 또는 육질이 우수한 돼지를 생산하기 위한 유전자 마커 로서의 활 용 가능성에 대한 연구를 수행 하였다. 확인된 ECI2 단일염기 다형성과 Berkshire 돼지 430두에 대한 Veracode GoldenGate assay kit (Illumina San Dieg, CA) 실험 기법으로 유전자형 을 분석을 진행한 결과, major allele은 C (allele frequency: 0.515), minor allele은 G (allele frequency: 0.485)이며, 대립 유전자 빈도는(MAF) 0.4849, 하디-와인버그 법칙(HWE)은 0.0972, 단일염기다형성 선택 비율(call rate) 98.40%로 단일염 기다형성 분석을 위한 적합한 수준임을 확인하였다(Table 2). 이전에 ECI1 유전자의 발현과 Yorkshire, Diannan small-ear, Tibetan 돼지에서의 지방 침착 및 육질과의 연관성이 보고되 어 있지만(LU et al. 2017) ECI2 유전자에 대한 연구는 수행 되지 않았다. 따라서, 본 연구에서 처음으로 ECI2 유전자와 버크셔 돼지의 육질형질과의 연관성에 대한 연구를 수행하였다.

    육질 형질과의 연관성 분석

    버크셔 돼지 430두의 육질 형질 검사를 수행하고 유전자형 을 분석하여 유의적인 연관성을 분석하였다. 통계 분석은 우 성, 열성, 공우성 모델을 이용하여 분석한 결과, 우성 모델에 서 도 체중(p<0.05), 적색도(p<0.05), 육즙 손실(p<0.05), 지방 함량(p<0.01), 수분 함량(p<0.01) 및 pH24hr(p<0.05)에서 유의 성을 확인하였다(Table 3). 우수한 육질을 결정하는 중요한 형 질은 pH24hr, 보수력, 육즙 손실, 가열 감량이며(Bonneau & Lebret 2010) 우성 모델의 ECI2 GG+CG 그룹에서 CC 그룹 과 비교했을 때 육즙 손실이 감소하였고, pH24hr 증가하였다 (Table 3). 공우성 모델에서 적색도(p<0.05), pH24hr (p<0.05)에 서 유의성을 확인 하였고 GG 유전자형이 다른 유전자형에 비 해 pH24hr에서 증가되었다(Table 4). GG 유전자형을 가지는 돼지에서 육질이 우수하며 분자 육종 기술에 ECI2 유전자의 단일염기다형성을 이용할 경우 육질이 우수한 돼지 생산이 가 능할 것으로 사료된다. 열성 모델에서는 유의성을 확인할 수 없었지만, 다른 모델 분석 결과와 동일하게 pH24hr와 육즙 손 실에서 GG 유전자형이 더 좋은 값을 가지는 것이 확인되었다 (Table 5). 거세돈(barrow)과 암퇘지(gilt)로 분류하여 육질과의 연관성을 각각 분석한 결과, 거세돈에서 더 많은 육질 형질과 의 연관성을 확인하였다(Table 6-7). 본 연구에서는 거세돈의 가열 감량(p<0.01), pH24hr(p<0.01), 적색도(p<0.05, p<0.001)에 서 유의성을 나타내었고(Table 6), 암퇘지에서는 수분 함량 (p<0.01, p<0.05)에서만 유의성을 나타내었다(Table 7). 거세돈 에서 GG 유전자형이 pH24hr에서의 증가를 확인하였고, 유의성 은 확인할 수 없었지만 육즙 손실도 다른 유전자형에 비해 감 소하였다(Table 6). 이전에 연구된 보고에서, 암퇘지에 비해 거 세돈이 일당증체량이 높으며, 높은 pH를 가지는 것으로 알려 져 있는데(Hah et al. 2007;Kim et al. 2007) 본 연구 결과 또한 거세돈의 GG 유전자형이 동일한 결과를 나타남에 따라 거세돈의 육질이 더 우수함을 확인하였다. 또 다른 연구에서 근육 pH는 육질에 영향을 미치는 주요한 요인이며, 높은 pH 가 육즙 손실이나 수분 손실이 적으며, 육즙 손실과 보수력에 밀접한 관련이 있다는 보고가 있다(Huff-Lonergan et al. 2002;Josell et al. 2003). 본 연구에서 ECI2 유전자의 GG 유전자형이 육즙 손실이 감소되고 pH24hr에서 증가되어 이전의 다른 연구 결과와 동일한 결과를 갖는 것으로 확인되었다. 최 근의 분자유전학적 연구의 발달에 따라 육질과 직접적으로 관 련되어 있는 유전자들을 규명함으로써 육질이 우수한 돼지의 조기진단이 가능해지고 있다. 기존의 육종가 선발지수식에 ECI2 유전자를 추가하여 선발한다면 고품질 돈육 생산 증가 및 양돈 농가의 경쟁력 향상을 기대할 수 있을 것이다. 따라 서, 본 연구의 결과 육질을 결정짓는 사후 pH에 대한 ECI2 유전자의 돌연변이를 육질이 우수한 돼지를 선별할 수 있는 유전자 마커로 사용 가능할 것으로 사료된다.

    적 요

    본 연구는 돼지 농가의 생산성 향상 및 수익성 증대를 위한 분자 육종 기술에 적용할 유전자 마커를 개발하기 위해 수행 되었다. 분석 결과에 따르면, 돼지의 간 조직을 이용하여 RNA-Sequencing을 수행한 결과 ECI2 유전자의 SNP를 발견 하였고 발견된 SNP chr 7:g.2302809는 c.608로 608번째 C 가 G로 변환되어 Threonine에서 Serine으로 아미노산이 치환 되는 단일염기다형성임을 확인하였다. Berkshire 돼지 430으로 ECI2 유전자형과 육질 형질과의 연관성 분석 결과 도 체중, 적색도, 육즙 손실, 수분 함량 및 pH24hr에서 유의성을 확인할 수 있었다. 그중 GG 유전자형은 pH24hr에서 다른 유전자형에 비해 수치가 증가시키는 경향을 확인하였다. 성별에 따른 유 전자형과 육질 형질과의 연관성은 거세돈에서 GG 유전자형이 육즙 손실의 감소와 pH24hr에서 유의성이 확인되었고, 암퇘지 의 GG 유전자형도 수분함량이 증가되었다. 따라서 ECI2 유 전자의 GG 유전자형을 가진 돼지가 육질이 더 좋은 것으로 판단된다. 이러한 결과를 바탕으로 ECI2의 GG 유전자형을 고 정시킨다면 육질이 우수한 돼지고기 생산이 가능할 것이다. 또 한 ECI2 유전자를 이용하여 품종개량 및 조기 선발 기술에 바이오마커로 활용한다면 농가의 경쟁력 강화 효과에 도움이 될 것으로 사료된다.

    ACKNOWLEDGMENTS

    이 논문은 2017년도 경남과학기술대학교 대학 회계 연구비 지원에 의하여 연구되었다.

    Figure

    Table

    The identification of SNPs in the ECI2 gene by RNASequencing

    Summary of ECI2 genotyping analysis

    Analysis of association between ECI2 SNP and pork meat quality traits by dominant model

    Analysis of association between ECI2 SNP and pork meat quality traits by codominant model

    Analysis of association between ECI2 SNP and pork meat quality traits by recessive

    Association between a SNP in the ECI2 gene and meat quality traits in Barrow

    Association between a SNP in the ECI2 gene and meat quality traits in Gilt

    Reference

    1. AndersonS. 2007. Determination of fat, moisture, and protein in meat and meat products by using the FOSS FoodScan near-infrared spectrophotometer with FOSS artificial neural network calibration model and associated database: collaborative study . J. AOAC Int.90: 1073-83.
    2. BonneauM. & LebretB. 2010. Production systems and influence on eating quality of pork . Meat Sci.84: 293-300.
    3. ChoH.R. , HaJ. , KwonS.G. , HwangJ.H. , ParkD.H. , KimT.W. , LeeH.K. , SongK.D. , KimS.W. & KimC.W. 2015. Single- Nucleotide Polymorphisms in Pig EPHX1 Gene are Associated with Pork Quality Traits . Anim Biotechnol.26: 237-42.
    4. CrawfordS. , MoellerS. , ZerbyH. , IrvinK. , KuberP. , VellemanS. & LeedsT. 2010. Effects of cooked temperature on pork tenderness and relationships among muscle physiology and pork quality traits in loins from Landrace and Berkshire swine . Meat Sci.84: 607-12.
    5. HahK.-H. , KimI.-S. , JinS.-K. , NamY.-W. & ChoJ.-H. 2007. Proximate composition and physico-chemical characteristics of Berkshire pork by gender . Korean J Food Sci Anim Resour.27: 137-41.
    6. Huff-LonerganE. , BaasT.J. , MalekM. , DekkersJ.C. , PrusaK. & RothschildM.F. 2002. Correlations among selected pork quality traits . J. Anim Sci.80: 617-27.
    7. HwangJ.H. , AnS.M. , KwonS.G. , ParkD.H. , KimT.W. , KangD.G. , YuG.E. , KimI.S. , ParkH.C. , HaJ. & KimC.W. 2017a.  Associations of the Polymorphisms in DHRS4, SERPING1, andAPOR Genes with Postmortem pH in Berkshire Pigs . Anim Biotechnol.28: 288-93.
    8. HwangJ.H. , HaJ. , KwonS. , AnS.M. , YuG.E. , ParkD.H. , KangD.G. , KimT.W. , ParkH.C. , KimI.S. & KimC.W. 2017b. Nonsynonymous SNP in the Ribosomal protein S3 (RPS3) gene and its Association with Meat Quality Traits in Berkshire pigs. J. Agric . Life. Sci.51: 151-61.
    9. HwangJ.H. , KwonS.G. , ParkD.H. , KimT.W. , KangD.G. , HaJ. , KimS.W. & KimC.W. 2014. Molecular characterization of porcine PGM1 gene associated with meat quality traits . Canadian Journal of Animal Science.95: 31-6.
    10. JosellA. , von SethG. & TornbergE. 2003. Sensory quality and the incidence of PSE of pork in relation to crossbreed and RN phenotype . Meat Sci.65: 651-60.
    11. KayanA. , CinarM.U. , UddinM.J. , PhatsaraC. , WimmersK. , PonsuksiliS. , TesfayeD. , LooftC. , JuengstH. , TholenE. & SchellanderK. 2011. Polymorphism and expression of the porcineTenascin C gene associated with meat and carcass quality . Meat Sci.89: 76-83.
    12. KeoghK. , KennyD.A. , CormicanP. , McCabeM.S. , KellyA.K. & WatersS.M. 2016. Effect of Dietary Restriction and Subsequent Re-Alimentation on the Transcriptional Profile of Bovine Skeletal Muscle . PLoS One.11, e0149373.
    13. KimH. , KimB. , KimH. , IimH. , YangH. , LeeJ. , JooY. , DoC. , JooS. & JeonJ. 2007. Estimation of terminal sire effect on swine growth and meat quality traits . J. Anim. Sci. Technol.49: 161-70.
    14. KwonS.G. , HwangJ.H. , ParkD.H. , KimT.W. , KangD.G. , KangK.H. , KimI.-S. , HaJ. & KimC.W. 2016. Effects of a non-synonymous CBG gene single nucleotide polymorphism (SNP) on meat-quality traits in Berkshire pigs . CAN J ANIM SCI.96: 45-51.
    15. LU Y.-f., CHEN J.-b., ZHANG B., LI Q.-g., WANG Z.-x., ZHANG H. & WU K.-l. 2017. Cloning, expression, and polymorphism of the ECI1 gene in various pig breeds . J Integr Agr.16: 1789-99.
    16. MortimerS.I. , van der WerfJ.H. , JacobR.H. , HopkinsD.L. , PannierL. , PearceK.L. , GardnerG.E. , WarnerR.D. , GeesinkG.H. , EdwardsJ.E. , PonnampalamE.N. , BallA.J. , GilmourA.R. & PethickD.W. 2014. Genetic parameters for meat quality traits of Australian lamb meat . Meat Sci.96: 1016-24.
    17. MourotJ. , KoubaM. & PeiniauP. 1995. Comparative study of in vitro lipogenesis in various adipose tissues in the growing domestic pig (Sus domesticus) . Comp Biochem Physiol B Biochem Mol Biol.111: 379-84.
    18. MursulaA.M. , van AaltenD.M. , HiltunenJ.K. & WierengaR.K. 2001. The crystal structure of Δ 3-Δ 2-enoyl-CoA isomerase . J Mol Biol.309, 845-53.
    19. NafikovR.A. & BeitzD.C. 2007. Carbohydrate and lipid metabolism in farm animals . J Nutr.137: 702-5.
    20. NguyenP. , LerayV. , DiezM. , SerisierS. , Bloc’hJ.L. , SiliartB. & DumonH. 2008. Liver lipid metabolism . Journal of animal physiology and animal nutrition.92: 272-83.
    21. O'HeaE.K. & LeveilleG.A. 1969. Significance of adipose tissue and liver as sites of fatty acid synthesis in the pig and the efficiency of utilization of various substrates for lipogenesis . J Nutr.99: 338-44.
    22. ParkB. , ChoS. , YooY. , KoJ. , KimJ. , ChaeH. , AhnJ. , LeeJ. , KimY. & YoonS. 2001. Animal products and processing: Effect of carcass temperature at 3hr post-mortem on pork quality . J. Anim. Sci. Technol (Kor.). 43: 949-54.
    23. ParkW.B. , AnS.M. , YuG.E. , KwonS. , HwangJ.H. , KangD.G. , KimT.W. , ParkH.C. , HaJ. & KimC.W. 2017. The rs196952262 Polymorphism of the AGPAT5 Gene is Associated with Meat Quality in Berkshire Pigs . Korean J Food Sci Anim Resour.37: 926-30.
    24. ReyerH. , ShiraliM. , PonsuksiliS. , MuraniE. , VarleyP.F. , JensenJ. & WimmersK. 2017. Exploring the genetics of feed efficiency and feeding behaviour traits in a pig line highly selected for performance characteristics . Mol Genet Genomics.292(5): 1001-11.
    25. SaunaZ.E. , Kimchi-SarfatyC. , AmbudkarS.V. & GottesmanM.M. 2007. Silent polymorphisms speak: how they affect pharmacogenomics and the treatment of cancer . Cancer Res.67: 9609-12.
    26. SchefflerT.L. & GerrardD.E. 2007. Mechanisms controlling pork quality development: The biochemistry controlling postmortem energy metabolism . Meat Sci.77: 7-16.
    27. van WeeghelM. , OfmanR. , ArgmannC.A. , RuiterJ.P. , ClaessenN. , OussorenS.V. , WandersR.J. , AtenJ. & HoutenS.M. 2014. Identification and characterization of Eci3, a murine kidney-specific Delta3,Delta2-enoyl-CoA isomerase . FASEB J.28: 1365-74.
    28. van WeeghelM. , te BrinkeH. , van LentheH. , KulikW. , MinklerP.E. , StollM.S. , SassJ.O. , JanssenU. , StoffelW. , SchwabK.O. , WandersR.J. , HoppelC.L. & HoutenS.M. 2012. Functional redundancy of mitochondrial enoyl-CoA isomerases in the oxidation of unsaturated fatty acids . FASEB J.26: 4316-26.
    29. WarnerR.D. , GreenwoodP.L. , PethickD.W. & FergusonD.M. 2010. Genetic and environmental effects on meat quality . Meat Sci.86: 171-83.
    30. WoodJ. , EnserM. , FisherA. , NuteG. , WhittingtonF. & RichardsonR. 2005. Effects of diets on fatty acids and meat quality . Options Méditerranéennes, Series A.67: 133-41.
    31. WoodJ.D. , NuteG.R. , RichardsonR.I. , WhittingtonF.M. , SouthwoodO. , PlastowG. , MansbridgeR. , da CostaN. & ChangK.C. 2004. Effects of breed, diet and muscle on fat deposition and eating quality in pigs . Meat Sci.67: 651-67.
    32. WuG. , FaroukM.M. , ClerensS. & RosenvoldK. 2014. Effect of beef ultimate pH and large structural protein changes with aging on meat tenderness . Meat Sci.98: 637-45.
    33. YuG.E. , KwonS. , HwangJ.H. , AnS.M. , ParkD.H. , KangD.G. , KimT.W. , KimI.S. , ParkH.C. , HaJ. & KimC.W. 2017. Effects of cell death-inducing DFF45-like effector B on meat quality traits in Berkshire pigs . Genet Mol Res.16.